T2826bul targetron vector pacd4k-c-loxp nd,phc 12-05-1.doc

TargeTron Vector pACD4K-C-loxP

Catalog Number T2826
Storage Temperature –20 °C
TECHNICAL BULLETIN
Product Description
The TargeTron vector, pACD4K -C-loxP, is a 7,745 bp Escherichia coli expression vector to be used in conjunction with the TargeTron Gene Knockout
System, Catalog Number TA0100. This vector differs
from the original pACD4K -C vector in that it has loxP
sites flanking each end of the kanamycin ORF. The
addition of the loxP sites on this vector allows for
multiple site-specific knockouts in the same bacterial
chromosome. After an initial “targetron” chromosomal
insertion, the kanamycin resistance marker used to
select for insertions can be removed via Cre-loxP
mediated recombination.1,2 After removal of the
kanamycin resistance marker, sequential “targetron”
insertions can be generated.3

Map Features of TargeTron pACD4K-C-loxP vector

Map Position
loxP sites that flank the kanamycin-RAM:
5′ loxP sequence
5′ - CTACTTCGTATAGCATACATTATACGAAGTTAT - 3′ Note: The mutated 5′ loxP site shown above was found
to be more efficient than the wild-type loxP site in conjunction with targeted group II intron insertions. 3′ loxP sequence:
5′ – ATAACTTCGTATAGCATACATTATACGAAGTTAT – 3′
B. Sub-cloning into host specific shuttle vectors Supplied at 25 ng/µl in 10 mM Tris-HCl, pH 8.0, with 1 mM EDTA. The provided pACD4K -C-loxP vector is The TargeTron system has previously been linearized at the Hind III and BsrG I sites. adapted to other bacterial hosts by sub-cloning the essential intron components into shuttle/expression Precautions/Disclaimer
vectors. Prior to sub-cloning, the pACD4K-C-loxP This product is for R&D use only, not for drug, vector needs to be circularized. This can be done household, or other uses. Please consult the Material by running the lacZ control reaction in the Safety Data Sheet for information regarding hazards TargeTron kit (Product Number TA0100). For adaptation to another host, it is advised to target an easily screenable gene. Sub-cloning the region bound by Hind III and PshA I into an alternative host shuttle vector downstream of a host specific promoter should result in a functional Targetron Procedures
expression vector. The Hind III-PshA I region A. Removal of kanamycin by Cre-loxP mediated should contain the intron RNA and LtrA reverse transcriptase coding regions, as well as the transcriptional terminator. In the final TargeTron 1. After the initial “targetron” insertional knockout has shuttle vector, the Hind III and BsrG I sites should been confirmed, make the knockout strain be unique since these are used to routinely re- competent using the RapidTransit Transformation target the intron to knockout specific genes. Kit , Catalog Number R2653, or an alternative 2. Obtain a plasmid expressing Cre-recombinase that has a selectable marker other than kanamycin The lox-P kanamycin RAM is bound by two Mlu I (e.g., chloramphenicol, tetracycline, etc.). sites. The loxP-kan-RAM can be removed by Mlu I 3. Transform the knockout strain with the Cre plasmid digestion and replaced with other DNA such as according to the supplier’s recommendations. promoters (for mitigating polar effects, if needed), 4. Grow and select for transformants at the reporter genes, other antibiotic RAM-type markers, appropriate temperature with the appropriate etc. The Mlu I site has been used to successfully deliver a trimethoprim–RAM,3 a kanamycin-RAM 5. Once transformants are obtained, express the Cre (plasmid pACD4K-C in the TA0100 kit and the pACD4K-C-loxP plasmid provided here), and a recommendations (e.g., shifting temperature from lacZα gene.5 The efficiency of the intron may be 30 °C to 37 °C for plasmids with thermosensitive affected by insertions at the Mlu I site. A good starting point is to attempt to insert an intron 6. Check for removal of kanamycin by replica plating containing heterologous DNA into an easily isolated colonies on LB and LB+Kan (25 µg/ml). screenable or selectable gene, such as lacZ. 7. Further verification for removal of kanamycin (~1.0 kb) can be done by colony PCR using gene References:
specific or intron specific primers spanning the 1. Abremski, K. et al., J. Biol. Chem., 261 (1), 391-396
8. The PCR amplicon can then be submitted for 2. Hartung, M. et al., J. Biol. Chem., 273 (36), 22884-
sequencing. There will be a single loxP scar remaining within the “targetron” once the 3. Zhong, J. et al., Nucleic Acids Res., 31 (6), 1656-
4. Buchholz, F. et al., Nucleic Acids Res., 24 (15),
5. Jones, J.P. et al., Mol. Ther., 11 (5), 687-94 (2005).
RapidTransit is a trademark of Sigma-Aldrich Biotechnology.
TargeTron is a registered trademark of InGex , L.L.C.
LICENSE AGREEMENT
Academic and Non-Profit Laboratory Assurance Letter This product and its use are the subject of one or more of U.S. Patent The T7 system is based on technology developed at Brookhaven Nos. 5,698,421, 5,804,418, 5,869,634, 6,027,895, 6,001,608, and National Laboratory under contrac t with the U.S. Department of 6,306,596 and/or other pending U.S. and foreign patent applications Energy and is the subject of patent applications assigned to controlled by InGex, LLC. BEFORE OPENING OR USING THIS Brookhaven Science Associates, LLC. (BSA). BSA will grant a non- PRODUCT, PLEASE READ THE TERMS AND CONDITIONS SET exclusive license for the use of this technology, including the FORTH BELOW. YOUR USE OF THIS PRODUCT SHALL enclosed material, based upon the following assurances: CONSTITUTE ACKNOWLEDGMENT AND ACCEPTANCE OF THESE TERMS AND CONDITIONS. If you do not agree to use this 1. These materials are to be used for noncommercial research product pursuant to the following terms and c onditions, please purposes only. A separate license is required for any commercial contact Sigma Technical Services to return the unused and unopened use, including use of these materials for research purposes or production purposes by any commercial entity. Information about commercial licenses may be obtained from the Office of Intellectual The purchase of this product conveys to you, the buyer, the non- Property & Sponsored Research, Brookhaven National Laboratory, transferable right to use the purchased product in non- Bldg. 475D, P.O. Box 5000, Upton, New York 11973-5000, commercialized research conducted by you. Sigma does not have the right to grant you a license to use this product for any other purposes. If you wish to use this product for any non-research purposes, you 2. No materials that contain the cloned copy of T7 gene 1 , the gene must obtain a separate commercial license from InGex LLC. for T7 RNA polymerase, may be distributed further to third parties Commercial entities may use this product for research and evaluation outside of your laboratory, unless the recipient receives a copy of this purposes for one year from the date of purchase. IF YOU ARE A license and agrees to be bound by its terms. This limitation applies to COMMERCIAL ENTITY, YOUR RIGHT TO USE THIS PRODUCT strains of BL21(DE3), BL21(DE3)pLysS, and BL21(DE3)pLysE, and EXPIRES ONE YEAR FROM THE DATE OF PURCHASE. Any commercial entity that wishes to use this product beyond this one- year period, must obtain a commercial license from InGex, LLC. You may refuse this license by returning the enclosed materials unused. By keeping our using the enclosed materials, you agree to You may not transfer the product, its components or any materials or information made through the use of this product for any non- academic research related purpose (e.g., commercial research or commercialization). You may (a) make such a transfer to a scientific collaborator for research purposes if such collaborator agrees to abide by the usage terms and conditions, (b) disclose in a peer reviewed scientific publication information made through the use of the product and (c) deposit materials made through use of the product as required in association with a peer reviewed scientific publication, provided the recipient is under an obligation not to use or distribute the materials for any non-research purpose (d) transfer any materials used in the published experiments freely to academic researchers for their own research purposes. Your right to use the product will terminate immediately if you fail to comply with these terms and conditions. You shall, upon such termination of your rights, destroy all product and components thereof in your control, and notify For information on purchasing a license to this product for purposes other than non-commercial research, contact Licensing Department, InGex, LLC, 3655 Vista Ave, St. Louis, MO 63110, 314-865-0113. Sigma brand products are sold through Sigma-Aldrich, Inc. Sigma-Aldrich, Inc. warrants that its products conform to the information contained in this and other Sigma-Aldrich publications. Purchaser must determine the suitability of the product(s) for their particular use. Additional terms and conditions may apply. Please see reverse side of

Source: http://www.sial.co.kr/promotion/sig/2009_q2_promotion/img/t2826bul.pdf