The effect of naltrexone on alcohols stimulant properties and selfadministration behavior in social drinkers: influence of gender and genotype

A l c o h o l i s m : C l i n i c a l a n d E x p e r i m e n t a l R e s e a r c h The Effect of Naltrexone on Alcohol’s Stimulant Properties and Self-Administration Behavior in Social Drinkers: Influence of Gender and Genotype Elaine Setiawan, Robert O. Pihl, Sylvia M. L. Cox, Christina Gianoulakis, Roberta M. Palmour, Chawki Benkelfat, and Marco Leyton Background: Few pharmacological treatments for alcohol dependence are available. Moreover, the best supported treatment, naltrexone hydrochloride, appears to work for only some.
Methods: To investigate potential predictors of these differential responses, 40 social drinkers (20 women) were administered 6 days of treatment with naltrexone vs. placebo in a double-blind,counterbalanced, crossover design. At the end of each treatment period, participants received asingle dose of their preferred alcoholic beverage followed by the opportunity to work for addi-tional alcohol units using a progressive ratio (PR) breakpoint paradigm. All subjects but one weregenotyped for the A118G polymorphism of the mu opioid receptor gene (OPRM1).
Results: Naltrexone decreased the ethanol-induced ‘euphoria’ to a priming dose of alcohol in two subgroups: (i) in women, and (ii) in subjects with the A118G polymorphism of the mu opioidreceptor gene (OPRM1). Naltrexone did not decrease motivation to work for additional alcoholicbeverages on the PR task regardless of gender or genotype.
Conclusions: The results add to the evidence that naltrexone decreases positive subjective effects of alcohol, with preferential effects in distinct subgroups. Similar effects in heavier drinkersmight decrease alcohol use.
Key Words: Alcohol Dependence, Opioids, Addiction, Individual Differences.
E THANOL ADMINISTRATION INDUCES the reported clinical trials indicate positive effects of naltrexone, release of endogenous opioids in laboratory rodents there are also multiple negative reports (Krystal et al., 2001; (Marinelli et al., 2003, 2005) and in humans (Dai et al., 2002).
Killeen et al., 2004; O’Malley et al., 2007; though, for a Conversely, administration of the opioid receptor antagonist, reanalysis of two negative findings, see Gueorguieva et al., naltrexone (Revia), has been reported to decrease alcohol’s 2007). Laboratory studies in social drinkers have also yielded positive subjective effects and drinking behavior. For exam- inconsistent results; naltrexone failed to decrease ad lib alco- ple, in alcohol-dependent patients, naltrexone has been found hol ingestion in two studies (Davidson et al., 1996; Drobes to decrease alcohol intake and the ability of alcohol exposure et al., 2003) while the significant effects seen in two others to precipitate binges (Anton et al., 2004; Berglund, 2005; were proposed to reflect nonspecific sedation and nausea Drobes et al., 2003; Feinn and Kranzler, 2005; O’Malley (Davidson et al., 1999; de Wit et al., 1999).
et al., 1992; Oslin et al., 1999; Volpicelli et al., 1992). In labo- Some of the above discrepant findings might be explained ratory studies conducted in heavy social drinkers, naltrexone by different effects in subpopulations. For example, a retro- can diminish subjective stimulant effects of alcohol and the spective analysis of an existing dataset suggested that naltrex- urge to drink (Davidson et al., 1999; King et al., 1997; Na one may be clinically more effective in women than men and Lee, 2002; Peterson et al., 2006; Ray and Hutchison, (Kiefer et al., 2005). Although this was not replicated in two 2007; Swift et al., 1994). However, although the majority of subsequent retrospective analyses (Baros et al., 2008; Green-field et al., 2010), preferential effects were seen in women inthe one prospective study reported to date (Tidey et al., From the Department of Neurology and Neurosurgery (ES, SMLC, CB, ML); Department of Psychology (ROP, ML); and Department of Psychiatry (ROP, CG, RMP, CB, ML), McGill A second potential predictor of differential responses to naltrexone is genetic variation of the OPRM1 gene that Received for publication March 18, 2010; accepted November 23, 2010.
encodes for the mu opioid receptor. The most common vari- Reprint requests: Marco Leyton, PhD, Department of Psychiatry, ant is the A118G single nucleotide polymorphism, which McGill University, 1033 Pine Avenue West, Montreal, Quebec,Canada H3A 1A1. Tel.: 514-398-5804; Fax: 514-398-4866; E-mail: results in an amino acid substitution of Asn40Asp (Bergen et al., 1997). This mutation has been reported to enhance Copyright Ó 2011 by the Research Society on Alcoholism.
alcohol-induced positive subjective effects and craving responses in nondependent users (Ray and Hutchison, 2004; Alcohol Clin Exp Res, Vol 35, No 6, 2011: pp 1–8 van den Wildenberg et al., 2007) and is associated with Symptom Check List (SCL) including ‘‘headache,’’ ‘‘nausea ⁄ greater effects of naltrexone in both social drinkers (Ray and vomiting,’’ ‘‘fatigue,’’ and ‘‘abdominal cramps.’’ Participants rated Hutchison, 2007) and alcohol abusers (Oslin et al., 2003; severity of each symptom on a 5-point rating scale from ‘‘not at all’’to ‘‘severe.’’ Anton et al., 2008; though, see also Gelernter et al., 2007; On the sixth day of each treatment, participants arrived at noon at our Clinical Research Unit for their test day. Participants were asked To address these issues further under controlled laboratory to abstain from alcohol for at least 24 hours before the test session conditions, we tested the effects of naltrexone in a sample of and to abstain from nicotine and caffeine on the test day A breatha- male and female social drinkers genotyped for polymor- lyzer confirmed abstinence from alcohol. Urine screens confirmedcompliance with the treatment regimen (all participants had visually phisms of the mu opioid receptor. Alcohol self-administration detectable riboflavin under UV light, 366 nm) (Del Boca et al., behavior was measured using a progressive ratio (PR) break- 1996). All subjects tested negative on a urine drug screen sensitive to point paradigm, an objective behavioral measure of motiva- cocaine, opiates, phencyclidine, barbiturates, D9–tetrahydrocannabi- tion to seek reward (Barrett et al., 2006, 2008). Positive and nol, benzodiazepines, and amphetamines (Triage Panel for Drugs of other subjective effects of alcohol were measured with self- Abuse; Biosite Diagnostics, San Diego, CA). All women tested nega-tive on a urine hCG test. Crossover occurred after a minimum 7-day washout period. In women, both drug regimens and test days tookplace during the follicular phase of their cycle or during the placebo week of their oral contraceptive pill.
Forty-two healthy, medication-free, social drinkers entered the study. The participants were healthy social drinkers, aged 18–50 who The alcohol self-administration paradigm followed the same pro- ingested a minimum of 5 alcoholic units per week (1 unit = 1.5 oz cedures as used in our previous studies (Barrett et al., 2006, 2008).
of 80-proof alcohol; 12 oz of beer; 5 oz of wine) and scored £5 on Subjects performed all tasks individually to rule out the social aspect the MAST. Participants were excluded for any of the following: cur- of drinking, except for the presence of one of the researchers. At rent or past dependence on substances other than nicotine or caf- 2:00 pm, subjects received a priming drink (their preferred 80-proof feine; current major axis I psychiatric disorder; past major axis I alcohol beverage mixed with caffeine-free soda or juice) to normalize psychiatric disorders except unipolar mood or anxiety disorders in drinking in the laboratory setting and to measure the response to a current, sustained, medication-free remission; cardiovascular, neuro- standard ethanol unit (males: 12 g; females: 10.4 g). The lower dose logical, or other disorders that might be aggravated by participation for women was to compensate for sex differences in ethanol pharma- in the study or complicate interpretation of the study’s results (e.g., cokinetics (Baraona et al., 2001). Subjects were then offered the liver enzymes ‡ 2.5 times above normal, abnormal ECG, body mass opportunity to work for up to 10 additional drinks, each containing index £ 19 or >26); acute hepatitis, liver failure, or other liver disor- half the standard unit of alcohol (males: 6 g; females: 5.2 g) vs.
ders that might be aggravated by alcohol and ⁄ or naltrexone expo- water, on a computerized PR schedule. The PR breakpoint para- sure; subjects currently taking opioid analgesics or other opioid digm was used as an objective, behavioral measure of motivation to containing medications; and, in women, a positive pregnancy test or obtain alcohol. Subjects were offered the option of drinking more not using a reliable method of birth control.
alcohol, water, or neither. To receive one extra drink (water or alco- Participants were recruited using a three-stage identification proce- hol), participants were required to press keys on a computer key- dure. (i) Volunteers were initially screened during a semi-structured board 40 times. To receive a second drink required pressing 60 telephone interview. (ii) Those who were interested and tentatively times. Up to a maximum of 10 selections from each drink category met the entry criteria were invited to a face-to-face interview using (water and alcohol) was permitted (PR = 40, 60, 90, 135, 203, 304, the Structured Clinical Interview for DSM-IV (SCID, First et al., 456, 684, 1,026, 1,538 key presses) although participants were not 1995) and the Michigan Alcohol Screen Test (MAST, Pokorny et al., informed of the maximum. The maximum alcohol load was 1972) a brief measure of lifetime alcohol problems indicative of possi- 1.25 ml ⁄ kg. The session proceeded as follows: ble abuse or dependence. (iii) Volunteers underwent a physical exami- 1. Participant fills in subjective state scales.
nation by a physician at the Medisys clinic, who determined whether 2. Participant exposed to glass of water (sight, smell).
subjects met inclusion ⁄ exclusion criteria, with laboratory tests as 3. Participant fills in subjective state scales.
deemed appropriate, to ensure that they were medically safe to par- 4. Participant exposed to favorite alcoholic beverage (sight, smell).
ticipate. Two female participants withdrew from the study after com- 5. Participant fills in subjective state scales.
pleting 1 and 3 days of the first week, respectively. Both had been 6. Participant asked to have one drink of favorite alcoholic beverage taking naltrexone, and both cited nausea and general malaise as the reason for discontinuing participation. Follow-up confirmed full 7. Participant rests for 15 min, filling in subjective state scales.
recovery within 48 hours. The study was approved by the Royal 8. Participant can button press to choose one of 3 possibilities: Victoria Hospital Research Ethics Board. All participants provided (i) Another alcoholic beverage, (ii) Water, or (iii) No beverage (if option (i) or (ii) chosen, participant was allowed to consume andfinish the drink at their own pace but could not begin to button press for a subsequent drink of the same kind until the previousdrink was completed) The study was a double-blind, randomized, placebo controlled, 9. Repeat step 8 up to maximum of 10 ‘‘earned’’ alcoholic drinks counter-balanced, crossover design. Participants received oral nal- OR remain seated to the time limit of 2 hours (neither detail was trexone (with a 50 mg riboflavin marker) or riboflavin alone in iden- tical capsules for 6 days. On Day 1 of the active treatment phase,subjects took 25 mg of naltrexone. If adverse side effects did not Participants were required to remain seated in front of the key- occur, subjects took 50 mg per day for the remaining 5 days. Side board until they had earned the maximum number of alcoholic effects of the drug were monitored after the initial dose, midway drinks or the 2-hour time limit had elapsed, whichever came first.
through the regimen and at the start of each test session using a After completing the procedure, subjects were required to remain GROUP DIFFERENCES IN NALTREXONE’S EFFECTS on-site until their blood alcohol level was below 0.04% at which time they were provided with a taxi home.
For the demographic data, 3-way ANOVAs were performed (Gender · Gene · Order). The self-administration and subjective data were analyzed by four- and five-way ANOVAs, (Drug · assessed throughout the test session. Two visual analogue scales Gender · Genotype · Order and Drug · Gender · Genotype · (VAS), anchored at 1 = ‘‘Least’’ to 10 = ‘‘Most,’’ were labeled Time · Order, respectively). In the presence of significant main Want a drink and Desire a Drink. Participants were instructed to effects or interactions, data were then investigated further using Least assess how they were feeling at each time referencing the ‘‘least or the Significant Difference post hoc tests, and Bonferroni corrections were most they could ever imagine feeling that way’’ to avoid ceiling or applied where appropriate. ANCOVAs were performed to rule out the effects of nausea, side effects, and individual patterns ofalcohol use. Correlations were calculated using Pearson’s correlation alcohol were measured with the Subjective High Assessment Scale(SHAS, Schuckit et al., 1997), and 11 VAS labeled Like the Drink,Sedated, Intoxicated, Euphoria, Mind Racing, Alert, Energetic, Excited, Rush, Anxiety, and High. SHAS items were examinedindividually as analogue scales anchored at 0 = ‘‘normal’’ to 10 = ‘‘extremely’’. Participants’ markings were measured in mm andcalculated as a percentage of the whole scale (54 mm). All items were As summarized in Table 1, subjects were nondependent assessed individually as the authors wished to examine the stimula- social drinkers. As a group, the participants averaged tory and sedative effects of alcohol separately.
15.5 ± 1.5 drinks per week. Men reported significantly moredrinks per current drinking episode than women (mean ± SEM, men: 7.0 ± 0.9; women: 4.8 ± 0.4, p < 0.05). There was a trend for the OPRM1 - ⁄ G allele carriers to report con- DNA, extracted from venous blood by the phenol- suming fewer alcohol units per week during their heaviest per- chloroform method, was available for 39 participants. The A118G iod of drinking than individuals with the A ⁄ A genotype polymorphism of the mu opioid receptor gene (OPRM1) was geno- (A ⁄ A, 22.0 ± 1.9; - ⁄ G, 14.9 ± 2.6, p < 0.10). There were typed according to the methods described by Bergen and colleagues no other group differences when subjects were separated by (1997). Amplification at an annealing temperature of 66°C, using for- ward primer 5¢CCTTGGCGTACTCAAGTTGCTC3¢ and reverseprimer 5¢TTCGGACCG CATGGGACGGAC3¢, produced a 95-bpproduct. After overnight digestion with Drd1, samples with a G sub- stitution (Asn 40) were cleaved into 22- and 73-bp fragments. Ethidi-um bromide-stained fragments were resolved on 5% polyacrylamide Side effects of headache, nausea ⁄ vomiting, fatigue, and gels and photographed under UV. All samples were amplified and abdominal cramps ⁄ pain were measured at the beginning of were typed unambiguously with 100% inter-rater reliability (2 raters).
The allele frequencies of 0.128 G and 0.872 A were not significantly each test session with the SCL. A total side effect score includ- different from those reported in Caucasian populations (Bergen ing all four symptoms was calculated. There were no main et al., 1997; Gelernter et al., 1999) and genotype frequencies were in effects of naltrexone treatment or any main or interaction Hardy–Weinberg equilibrium (0.026 GG, 0.205 GA, 0.769 AA).
effects with gender on any of the measures. In comparison, Because previously characterized control samples were not available, OPRM1 G-allele carriers reported significantly more side we sequenced 3 samples (1 each AA, AG, GG) bidirectionally withthe expected results. Genotypes were determined after randomization effects on naltrexone compared to placebo whereas the A ⁄ A and counterbalancing had occurred. This resulted in 7 ⁄ 9 (4 female) homozygotes had the opposite pattern at a trend level participants with the G-substitution in the Placebo-Naltrexone group (Drug · Gene, F1,28 = 3.5, p < 0.01, - ⁄ G OPRM1: Pbo, and 2 ⁄ 9 (female) in the Naltrexone-Placebo group.
0.9 ± 0.4, Nal, 1.5 ± 0.3, p < 0.05; A ⁄ A OPRM1: Pbo, Table 1. Breakdown of Participants by Gender and OPRM1 Genotype of A118G Polymorphism Current alcohol units ⁄ drinking episode* MAST, Michigan Alcoholism Screening Test.
aOne participant homozygous OPRM1 G ⁄ G. Numbers represent mean ± SEM.
bOne participant (male) not genotyped.
*Significant effect of gender, p < 0.05.
1.3 ± 0.2, Nal, 0.8 ± 0.2, p < 0.10). Based on these obser- including the covariates of total side effects (from SCL) vations, the total side effect score was used as a covariate in and total SHAS ‘‘nauseous’’ ratings from the naltrexone Subjective nausea was also measured with the SHAS item, For ‘‘euphoria,’’ the ANCOVA yielded significant Drug · ‘‘nauseous’’ at four times: (1) before any drinks (start); (2) Gender · Time (F3,81 = 3.0, p < 0.05) and Drug · Gene · after seeing the water (see water); (3) after seeing the alcohol Time interactions (F3,81 = 2.9, p < 0.05). In women, naltrex- (see alcohol); and (4) after drinking the priming dose of alco- one decreased ‘‘euphoria’’ after both seeing and drinking the hol (drink alcohol). There was a significant Drug · Gene · priming dose of alcohol compared to ratings during the pla- cebo session [Fig. 1A, see alcohol: Pbo, 1.5 ± 0.2 (adjusted (F3.96 = 3.1, p < 0.05). Here, OPRM1 A ⁄ A women experi- mean ± SEM); Nal, 1.0 ± 0.2, p < 0.05; drink alcohol: enced more nausea at the beginning of the naltrexone session Pbo, 2.1 ± 0.3; Nal, 1.3 ± 0.4, p < 0.05]. Men did not than the placebo session (start: Pbo, 0.00 ± 0.02; Nal, report differences in ‘‘euphoria’’ between the naltrexone and 0.02 ± 0.02; p < 0.05), while women with the G-allele placebo sessions at any time (Fig. 1B, p > 0.2). Carriers of reported feeling more nauseous after consuming the priming the G-allele also experienced decreased ‘‘euphoria’’ during the dose of alcohol during the naltrexone session when compared naltrexone session after seeing and drinking the alcohol prim- ing dose when compared to placebo (Fig. 1C, see alcohol: 0.08 ± 0.05; p < 0.05). Men did not report any significant Pbo, 1.6 ± 0.3; Nal, 0.9 ± 0.3; p < 0.05; drink alcohol: changes in nausea because of naltrexone at any time over the Pbo, 2.3 ± 0.3; Nal, 1.1 ± 0.5; p < 0.05), whereas this was test sessions. Based on these observations, the total SHAS not seen in the OPRM1 A ⁄ A participants (Fig. 1D, p > 0.2).
‘‘nauseous’’ scores over the naltrexone session were also used Although there were no Gene · Gender interactions, visual as covariates in subsequent analyses.
comparison of the marginal means suggested that naltrexone-induced reductions in ‘‘euphoria’’ were more pronounced inOPRM1 - ⁄ G women than in OPRM1 A ⁄ A women and - ⁄ G Effects of Naltrexone on Subjective Ratings men (- ⁄ G women: see alcohol: Pbo, 1.8 ± 0.4; Nal, Given the imbalance of women in the G-allele group (6 of 0.8 ± 0.3; drink alcohol: Pbo, 2.6 ± 0.4; Nal, 0.9 ± 0.7; 9) as well as a disproportionate number that received placebo A ⁄ A women: see alcohol: Pbo, 1.3 ± 0.3; Nal, 1.2 ± 0.2, on the first session (7 of 9), we examined subjective ratings in drink alcohol: Pbo, 1.6 ± 0.3; Nal, 1.6 ± 0.4; - ⁄ G men: see 5-way ANCOVAs (Drug · Gene · Gender · Time · Order).
alcohol: Pbo, 1.3 ± 0.5; Nal, 1.2 ± 0.4, drink alcohol: Pbo, Means are expressed as the adjusted means (±SEM) after OPRM1 -/G
score (mean±SEM) 1.50
score (mean±SEM)
S "euphoria
S "euphoria
see water
see alcohol
drink alcohol
see water
see alcohol
drink alcohol
OPRM1 A/A
score (mean±SEM) 1.50
score (mean±SEM) 1.50
S "euphoria
S "euphoria
see water
see alcohol
drink alcohol
see water
see alcohol
drink alcohol
Fig. 1. Effects of naltrexone on visual analogue scale (VAS) ‘‘euphoria’’ by gender and OPRM1 genotype. Placebo (grey diamonds) vs. naltrexone (black squares) in women, N = 19a (A), men, N = 17b,c (B), and participants with OPRM1 - ⁄ G, N = 9 (C) or OPRM1 A ⁄ A, N = 27 (D). *Post hoc comparisonp < 0.05 difference from placebo. aOne participant missing ‘‘euphoria’’ measure; btwo participants missing Symptom Check List measures; cone participantnot genotyped.
GROUP DIFFERENCES IN NALTREXONE’S EFFECTS Analysis of SHAS ‘‘high’’ ratings resulted in significant alcohol, 2.2 ± 0.2, p < 0.001 for drink alcohol rating com- Drug · Gender · Gene · Time (F3,84 = 2.8, p < 0.05) and pared to all other times). There were no significant effects of Drug · Gene · Time · Order (F3,84 = 2.8, p < 0.05) inter- Drug or Drug interactions on any of the remaining subjective actions after adjusting for nausea and side effects. Post hoc comparisons showed a significant naltrexone-induced reduc-tion in SHAS ‘‘high’’ in G-allele women after consuming the Effects of Naltrexone on Alcohol Self-Administration priming dose of alcohol (Fig. 2A, drink alcohol: Pbo,0.04 ± 0.05; Nal, )0.02 ± 0.04; p < 0.01). This decrease In the group as a whole, the earned alcoholic drinks during was not significant in any other subgroup (at drink alcohol: the test sessions were related to substance use outside of the A ⁄ A women, Pbo, 0.07 ± 0.03; Nal, 0.06 ± 0.02; A ⁄ A men, laboratory. The greater the number of alcoholic drinks Pbo, 0.08 ± 0.03; Nal, 0.07 ± 0.02; - ⁄ G men, Pbo, worked for on either session, the greater the lifetime use of 0.02 ± 0.06; Nal, 0.03 ± 0.05), and there were no other alcohol and the amount of alcohol used during the week prior significant contrasts (Fig. 2B,C,D). However, the Drug · to the beginning of each treatment regimen (previous week Gene · Time · Order interaction indicated that only G-allele drinking: Pbo, r = 0.402, p < 0.05; Nal, r = 0.503, p < carriers that received placebo on the first day experienced a 0.01; lifetime alcohol: Pbo, r = 0.338, p < 0.05; Nal, r = reduction in the alcohol-induced ‘‘high’’ because of naltrexone (drink alcohol: Pbo, 0.07 ± 0.04; Nal, 0.02 ± 0.03; p < Analyses of alcohol self-administration on the PR task did 0.01). Taken together, this would suggest that primarily the not yield any significant effects of naltrexone on breakpoints OPRM1 - ⁄ G women who received naltrexone on the second or total number of presses for alcoholic drinks. Covarying session experience a reduced ‘‘high’’ after consuming the nausea, side effects, and variations in individual alcohol use alcohol. However, this decrease in alcohol-induced ‘‘high’’ (current drinks per drinking episode, current drinks per week, was not observed in any other gene by gender combination heaviest period drinks per week, lifetime alcohol intoxica- that received naltrexone on the second day, suggesting the tions) did not reveal any significant effects. There were no sig- preferential effect in the G-allele women was not merely an nificant interactions with either gender or genotype (p ‡ 0.3).
Consumption of the alcohol priming dose increased subjec- tive intoxication without any significant main effects or inter-actions because of naltrexone, gender, or genotype (VAS The present study has three main findings. First, it repli- ‘‘intoxicated’’: main effect of Time, F3 = 4.3, p < 0.01; start, cates a now fairly consistent finding that naltrexone can 1.2 ± 0.1; see water, 1.2 ± 0.1; see alcohol, 1.2 ± 0.1; drink diminish stimulant and euphorigenic effects of alcohol.
Women OPRM1 -/G
Men OPRM1 -/G
SHAS "high" score (mean±SEM)
SHAS "high" score (mean±SEM)
see water
see alcohol
drink alcohol
see water
see alcohol
drink alcohol
Women OPRM1 A/A
Men OPRM1 A/A
SHAS "high" score (mean±SEM) -0.08
SHAS "high" score (mean±SEM)
see water
see alcohol
drink alcohol
see water
see alcohol
drink alcohol
Fig. 2. Effects of naltrexone on Subjective High Assessment Scale (SHAS) ‘high’ by gender and genotype. Placebo (grey diamonds) vs. naltrexone (black squares) in women with OPRM1 - ⁄ G, N = 6 (A), women with OPRM1 A ⁄ A, N = 14 (B), men with OPRM1 - ⁄ G, N = 3 (C), and men with OPRM1A ⁄ A, N = 14a (D). **Post hoc comparison p < 0.01 difference from placebo. aTwo participants missing Symptom Check List measures.
Second, it adds to a smaller literature suggesting that these further suggests that naltrexone does not diminish self-admin- effects occur preferentially in women and carriers of the G- istration behavior in social drinkers and extends the findings allele for the mu opioid receptor gene, OPRM1; those with to the use of a PR breakpoint paradigm.
both of these traits might be the most sensitive. Third, the Like all studies, this one is not without limitations. First, results do not support the hypothesis that these decrements in some of the subjects experienced naltrexone-induced nausea, subjective effects translate to decreased self-administration particularly those carrying the G-allele. However, only 5% of behavior in moderate social drinkers.
participants withdrew from the study, and neither nausea nor The majority of clinical trials with mu opioid receptor other side effects accounted for significant variance in the antagonists find evidence of decreased alcohol use; however, observed changes in subjective response to alcohol. Second, the group effects have been weak, seeming to occur in some the G-allele subgroup was small and not counterbalanced.
patients only (Bouza et al., 2004; Gueorguieva et al., 2007; However, the population frequency was as seen in other sam- Kranzler and Van Kirk, 2001; Srisurapanont and Jarusurai- ples (Gelernter et al., 1999; Oslin et al., 2003), and including sin, 2005; Streeton and Whelan, 2001). Preliminary evidence order in the statistical model still yielded preferential effects in suggests that some of this variability is attributable to genetic the G-allele carriers. Indeed, the results replicate quite closely variation of the OPRM1 gene (Anton et al., 2008; Oslin et al., Ray and Hutchison’s (2007) report that naltrexone reduces 2003). This possibility was supported by an initial laboratory alcohol’s stimulatory and positive subjective effects preferen- study in moderate to heavy social drinkers; G-allele carriers tially in social drinkers who carry the G-allele (n = 40, 15 G- exhibited a greater naltrexone-induced reduction in alcohol’s allele carriers). Third, the PR breakpoint paradigm has been stimulant and pleasurable effects (Ray and Hutchison, 2007).
used by us successfully before (Barrett et al., 2006, 2008; The present study provides a first laboratory replication.
Venugopalan et al., 2009) but it remains a laboratory model Gender has also recently emerged as a possible moderator with attendant artificial aspects (Davidson et al., 1999).
of naltrexone’s effects. The possibility that naltrexone might Despite this, individual differences in alcohol ingestion were be more efficacious in women than men was first suggested by well predicted by alcohol use on the street, suggesting that the a retrospective analysis of clinical trial data (Kiefer et al., PR breakpoint measure has validity, demonstrating good sen- 2005). In support, a subsequent prospective study in nontreat- sitivity to individual differences in substance use patterns. The ment seeking heavy drinkers suggested that naltrexone ability to detect naltrexone-induced reductions in alcohol con- decreased alcohol’s stimulant effects in women only (Tidey sumption may be limited to a heavier drinking population et al., 2008). In comparison, other clinical trials (Baros et al., (Drobes et al., 2003). Fourth, changes in subjective effects 2008; Greenfield et al., 2010) and laboratory studies (David- were primarily detected post consumption of the priming dose son et al., 1996; Drobes et al., 2003) suggest that naltrexone is of alcohol. These results were not unexpected; naltrexone equally effective in both men and women, although most may be diminishing the effects of ethanol-induced opioid studies seem not to have tested for gender differences. Gender release (Dai et al., 2002; Marinelli et al., 2003, 2005). In previ- differences, the present study suggests, still warrant further ous studies, naltrexone affected responses to alcohol but not placebo beverages or pre-alcohol measures (Ray and Hutchi- The observation that women with the A118G polymor- phism appear the most sensitive to naltrexone’s effects should In conclusion, the present laboratory study in moderate be considered preliminary. The subsamples were small, and social drinkers supports the evidence from heavy and depen- the interaction was influenced by an order effect in the case of dent drinking populations that naltrexone reduces alcohol’s SHAS ‘‘high’’. This noted, visual inspection of the ‘‘euphoria’’ positive subjective effects and that gender and OPRM1 geno- data also suggested that the naltrexone-induced reductions type moderate these effects. These naltrexone-induced occurred primarily in women with the OPRM1 - ⁄ G polymor- changes in subjective experience, though, did not translate to phism. Replication in future studies with larger samples of decreased alcohol self-administration in this population.
men and women G-allele carriers is required but may help Additional studies in large, prospectively genotyped, heavier explain, in part, negative findings in clinical trials when gender drinking populations may elucidate further naltrexone’s or genotype effects were examined separately.
effects on motivation to obtain alcohol as well as the influence Finally, our results do not support the proposition that nal- trexone can decrease alcohol self-administration in socialdrinkers, even in subgroups that reported diminished positive subjective effects. Previous work is consistent with this obser-vation. For example, Drobes and colleagues (2003) reported This work was supported by operating funds from Glaxo- that naltrexone decreased ad lib drinking in alcohol-depen- SmithKline to M.L. Both M.L. and C.B. are recipients of dent subjects but not in social drinkers. Similarly, naltrexone research chairs from McGill University. E.S. received scholar- failed to decrease ad lib alcohol ingestion in Davidson et al.
ships from the Canadian Institutes of Health Research (1996) while the significant effects seen in two other studies and McGill University Health Centre. We thank Li Bai, were thought to reflect nonspecific sedation and nausea Dominique Allard, and Kathleen Auclair for their excellent (Davidson et al., 1999; de Wit et al., 1999). The present study GROUP DIFFERENCES IN NALTREXONE’S EFFECTS Killeen TK, Brady KT, Gold PB, Simpson KN, Faldowski RA, Tyson C, Anton RF (2004) Effectiveness of naltrexone in a community treatment pro- Anton RF, Drobes DJ, Voronin K, Durazo-Avizu R, Moak D (2004) Nal- gram. Alcohol Clin Exp Res 28:1710–1717.
trexone effects on alcohol consumption in a clinical laboratory paradigm: King AC, Volpicelli JR, Frazer A, O’Brien CP (1997) Effect of naltrexone on temporal effects of drinking. Psychopharmacology 173:32–40.
subjective alcohol response in subjects at high and low risk for alcohol Anton RF, Oroszi G, O’Malley S, Couper D, Swift R, Pettinati H, Goldman dependence. Psychopharmacology 129:15–22.
D (2008) An evaluation of l-opioid receptor (OPRM1) as a predictor of Kranzler HR, Van Kirk J (2001) Efficacy of naltrexone and acamprosate for naltrexone response in the treatment of alcohol dependence. Arch Gen Psy- alcoholism treatment: a meta-analysis. Alcohol Clin Exp Res 25:1335– Baraona E, Abittan CS, Dohmen K, Moretti M, Pozzato G, Chayes ZW, Krystal JH, Cramer JA, Krol WF, Kirk GF, Rosenheck RA; Veterans Affairs Schaefer C, Lieber CS (2001) Gender differences in pharmacokinetics of Naltrexone Cooperative Study 425 Group (2001) Naltrexone in the treat- alcohol. Alcohol Clin Exp Res 25:502–507.
ment of alcohol dependence. N Engl J Med 345:1734–1739.
Baros AM, Latham PK, Anton RF (2008) Naltrexone and cognitive behav- Marinelli PW, Bai L, Quirion R, Gianoulakis C (2005) A microdialysis profile ioral therapy for the treatment of alcohol dependence: do sex differences of met-enkephalin release in the rat nucleus accumbens following alcohol exist? Alcohol Clin Exp Res 32:771–776.
administration. Alcohol Clin Exp Res 29:1821–1828.
Barrett SP, Pihl RO, Benkelfat C, Brunelle C, Young SN, Leyton M (2008) Marinelli PW, Quirion R, Gianoulakis C (2003) A microdialysis profile of The role of dopamine in alcohol self-administration in humans: individual beta-endorphin and catecholamines in the rat nucleus accumbens following differences. Eur Neuropsychopharmacol 18:439–447.
alcohol administration. Psychopharmacology (Berl) 169:60–67.
Barrett SP, Tichauer M, Leyton M, Pihl RO (2006) Nicotine increases alcohol Na C, Lee YS (2002) Alcohol urge and plasma ß-endorphin change after alco- self-administration in non-dependent male smokers. Drug Alcohol Depend hol challenge with naltrexone pretreatment in social drinkers. Prog Neuro- psychopharmacol Biol Psychiatry 26:663–670.
Bergen AW, Kokoszka J, Peterson R, Long JC, Virkkunen M, Linnoila M, O’Malley SS, Jaffe AJ, Chang G, Schottenfeld RS, Meyer RE, Rounsaville B Goldman D (1997) Mu opioid receptor gene variants: lack of association (1992) Naltrexone and coping skills therapy for alcohol dependence: a con- with alcohol dependence. Mol Psychiatry 2:490–494.
trolled study. Arch Gen Psychiatry 49:881–887.
Berglund M (2005) A better widget? Three lessons for improving addiction O’Malley SS, Sinha R, Grilo CM, Capone C, Farren CK, McKee SA, Roun- treatment from a meta-analytical study. Addiction 100:742–750.
saville BJ, Wu R (2007) Naltrexone and cognitive behavioral coping skills Bouza C, Angeles M, Mun˜oz A, Amate JM (2004) Efficacy and safety of nal- therapy for the treatment of alcohol drinking and eating disorder features in trexone and acamprosate in the treatment of alcohol dependence: a system- alcohol-dependent women: a randomized controlled trial. Alcohol Clin Exp atic review. Addiction 99:811–828.
Dai X, Thavundayil J, Gianoulakis C (2002) Differences in the responses Oslin DW, Berrettini W, Kranzler HR, Pettinati H, Gelernter J, Volpicelli JR, of the pituitary beta-endorphin and cardiovascular system to ethanol O’Brien CP (2003) A functional polymorphism of the mu-opioid receptor and stress as a function of family history. Alcohol Clin Exp Res 26: gene is associated with naltrexone response in alcohol-dependent patients.
Neuropsychopharmacology 28:1546–1552.
Davidson D, Palfai T, Bird C, Swift R (1999) Effects of naltrexone on Oslin DW, Pettinati HM, Volpicelli JR, Wolf AL, Kampman KM, O’Brien alcohol self-administration in heavy drinkers. Alcohol Clin Exp Res CP (1999) The effects of naltrexone on alcohol and cocaine use in dually addicted patients. J Subst Abuse Treat 16:163–167.
Davidson D, Swift R, Fitz E (1996) Naltrexone increases the latency to drink Peterson JB, Conrod P, Vassileva J, Gianoulakis C, Pihl RO (2006) Differen- alcohol in social drinkers. Alcohol Clin Exp Res 20:732–739.
tial effects of naltrexone on cardiac, subjective and behavioral reactions to Del Boca FK, Kranzler HR, Brown J, Korner PF (1996) Assessment of medi- acute ethanol intoxication. J Psychiatry Neurosci 31:386–393.
cation compliance in alcoholics through UV light detection of a riboflavin Pokorny AD, Miller BA, Kaplan HB (1972) The brief MAST: a shortened tracer. Alcohol Clin Exp Res 20:1412–1417.
version of the Michigan Alcoholism Screening Test. Am J Psychiatry Drobes DJ, Anton RF, Thomas SE, Voronin K (2003) A clinical laboratory paradigm for evaluating medication effects on alcohol consumption: nal- Ray LA, Hutchison KE (2004) A polymorphism of the mu-opioid receptor trexone and nalmefene. Neuropsychopharmacology 28:755–764.
gene (OPRM1) and sensitivity to the effects of alcohol in humans. Alcohol Feinn R, Kranzler HR (2005) Does effect size in naltrexone trials for alcohol dependence differ for single-site vs. multi-center studies? Alcohol Clin Exp Ray LA, Hutchison KE (2007) Effects of naltrexone on alcohol sensitivity and genetic moderators of medication response: a double-blind placebo- First MB, Spitzer RI, Gibbon M (1995) Axis I disorders. New York State Psy- controlled study. Arch Gen Psychiatry 64:1069–1077.
Schuckit MA, Tipp JE, Smith TL, Wiesbeck GA, Kalmijn J (1997) The rela- Gelernter J, Gueorguieva R, Kranzler HR, Zhang H, Cramer J, Rosenheck tionship between self-rating of the effects of alcohol and alcohol challenge R, Krystal JH; VA Cooperative Study #425 Study Group (2007) Opioid results in ninety-eight young men. J Stud Alcohol 58:202–210.
receptor gene (OPRM1, OPRK1, and OPRD1) variants and response to Srisurapanont M, Jarusuraisin N (2005) Naltrexone for the treatment of alco- naltrexone treatment for alcohol dependence: results from the VA Coopera- holism: a meta-analysis of randomized controlled trials. Int J Neuropsycho- tive Study. Alcohol Clin Exp Res 31:555–563.
Gelernter J, Kranzler H, Cubells J (1999) Genetics of two mu opioid receptor Streeton C, Whelan G (2001) Naltrexone, a relapse prevention maintenance gene (OPRM1) exon I polymorphisms: population studies, and allele fre- treatment of alcohol dependence: a meta-analysis of randomized controlled quencies in alcohol- and drug-dependent subjects. Mol Psychiatry 4:476– trials. Alcohol Alcohol 36:544–552.
Swift RM, Whelihan W, Kuznetsov O, Buongiorno G, Hsuing H (1994) Nal- Greenfield SF, Pettinati HM, O’Malley S, Randall PK, Randall CL (2010) trexone-induced alterations in human ethanol intoxication. Am J Psychiatry Gender differences in alcohol treatment: an analysis of outcome from the COMBINE study. Alcohol Clin Exp Res 34:1803–1812.
Tidey JW, Monti PM, Rohsenow DJ, Gwaltney CJ, Miranda R Jr, McGeary Gueorguieva R, Wu R, Pittman B, Cramer J, Rosenheck RA, O’Malley SS, JE, MacKillop J, Swift RM, Abrams DB, Shiffman S, Paty JA (2008) Mod- Krystal JH (2007) New insights into the efficacy of naltrexone-based reanal- erators of naltrexone’s effects on drinking, urge and alcohol effects in non- yses of two negative clinical trials. Biol Psychiatry 61:1290–1295.
treatment-seeking heavy drinkers in the natural environment. Alcohol Clin Kiefer F, Jahn H, Wiedemann K (2005) A neuroendocrinological hypothesis on gender effects of naltrexone in relapse prevention treatment. Pharmacop- Venugopalan VV, O’Hara C, Casey KF, O’Loughlin J, Benkelfat C, Fellows LK, Leyton M (2009) Lowered dopamine synthesis reduces the motivation to smoke in non-dependent and dependent smokers. Annual meeting of the mu-opioid receptor gene (OPRM1) influences cue-induced craving for alco- American College of Neuropsychopharmacology, Hollywood, Florida.
hol in male heavy drinkers. Alcohol Clin Exp Res 31:1–10.
Volpicelli JR, Alterman AI, Hayashida M, O’Brien CP (1992) Naltrexone in de Wit H, Svenson J, York A (1999) Non-specific effect of naltrexone on the treatment of alcohol dependence. Arch Gen Psychiatry 49:876–880.
ethanol consumption in social drinkers. Psychopharmacology (Berl) 146:33– van den Wildenberg E, Wiers RW, Dessers J, Janssen RG, Lambrichs EH, Smeets HJ, van Breukelen GJ (2007) A functional polymorphism of the

Source: http://staging.cusm.ca/sites/default/files/Setiawan_et_al_2011_0.pdf