Pharmacie française en ligne: Acheter des antibiotiques sans ordonnance en ligne prix bas et Livraison rapide.

Adml 803 oct/nov examination 2010

UNIVERSITY OF LIMPOPO
TURFLOOP CAMPUS
FACULTY OF SCIENCE & AGRICULTURE
SCHOOL OF MOLECULAR AND LIFE SCIENCES
DEGREE AND DIPLOMA EXAMINATIONS
(GENE EXPRESSION, FUNCTION
& MOLECULAR BIOLOGY TECHNIQUES)


INTERNAL EXAMINERS

PROF L.J. MAMPURU
DR V.G. MBAZIMA

EXTERNAL EXAMINER

PROF L-M BIRKHOLTZ
THIS PAPER CONSISTS OF FIVE (5) PAGES INCLUDING COVER PAGE

INSTRUCTIONS:
1. Answer all questions. 2. Write neatly and legibly. 3. Answer sections A and B in separate answer books. 4. The Genetic code table is attached. SECTION A
QUESTION 1
Describe two functions of DNA supercoiling. Discuss why a number of topoisomerase inhibitors are widely used as If you see a DNA structure simply written as CATAGCCG, what exactly does this mean in terms of a double-stranded structure and the polarity of the two chains? Explain your answer fully. Discuss the mechanism by which DNA polymerase III of E. coli achieves a high standard of fidelity in DNA synthesis. QUESTION 2
Explain the roles of the 5´-Cap and 3´-poly (A) tail of eukaryotic Describe what up-promoter- and down-promoter-mutations are. (4) There are about seven (7) proteins/enzymes that are utilized during the
process of Mismatch Repair. Identify these proteins/enzymes and explain the role of each in the mismatch repair system. The enzyme liverase is found only in the liver of mice (i.e., the enzyme is not found in any other organ such as spleen). However, you find that the gene encoding this enzyme is transcribed at equal rates in liver and spleen cells. By defining the level of liverase gene expression as the level of enzyme in the cell, list three points at which expression of the liverase gene might be differentially regulated in liver and spleen
QUESTION 3
Describe the action of TWO of the following antibiotics. Also indicate whether it is the prokaryotic and/or eukaryotic system that is/are The following structure is a Non-Template DNA fragment of gene X:
5´-…TCTGACTATTGAGCTCTCTGGCACATAGCA…-3´
Write the mRNA sequence that could be transcribed from Write the three possible reading frames that could be
obtained from the resultant mRNA in (i) above, Indicate the amino acid sequences that correspond to each of the reading frame above (ii). Clearly show the N- and C- Calculate the total energy required to synthesize a polypeptide of 600 SECTION B
QUESTION 1
Restriction endonucleases and restriction fragments b) Describe any two important features of a cloning vector. c) What is the role of dideoxy ribonucleoside triphosphates (ddNTPs) in DNA d) Why is DNA polymerase from E. coli and other mesophilic bacteria not QUESTION 2
a) Suppose that you have Drosophila gene R and you wish to find out if Sheep also contain a similar gene. Describe how you would go about detecting the presence of Drosophila gene R in Sheep. QUESTION 3
You have attempted to ligate a 2 kb fragment of foreign DNA into the Pst1 site in the multiple cloning site of the 3.4 kb plasmid vector shown below: a) To confirm the presence of the fragment of foreign DNA you perform Pst1 restriction enzyme digest. Draw the agarose gel band pattern that you would expect from the electrophoresis of recombinant and non- recombinant plasmids digested with Pst1 (Show the positive and negative electrodes, the direction of band movement and the sizes of the b) Since the 2kb fragment of foreign DNA is inserted into a tetracycline resistance gene in a plasmid, will cells containing the resulting recombinant plasmid be sensitive or resistant to tetracycline? Explain.

Source: http://www.ul.ac.za/application/downloads/papers/2011%20School%20Of%20Molecular%20and%20Life%20sciences/BIOC%20302%20Final%20Exam%202011.pdf

Charging lithium-ion batteries: not all charging systems are created equal

"Developing Affordable Mixed-Signal Power Systems for Battery Charger Applications" By Terry Cleveland, Staff Applications Engineer Scott Dearborn, Principal Applications Engineer INTRODUCTION As battery-powered electronic devices continue to become more common and more powerful, easily adaptable battery charger designs are needed. Using standard components, battery charger

world.kbs.co.kr

Title : Bring Me to Korea! Name : Afrizal Kurniawan Nationality : Indonesia Just three years ago, it's not a stretch to say that I knew pretty much nothing about Korea except for a few Korean dramas. The Korean girl groups and boy bands didn't impress me all that much. To be more exact, I looked down on them, thinking, "young teenagers singing??" Do I feel this way now? Abso

Copyright © 2010-2014 Pharmacy Drugs Pdf